1. Go to this page and download the library: Download bl4ckbon3/strsim library. Choose the download type require.
2. Extract the ZIP file and open the index.php.
3. Add this code to the index.php.
<?php
require_once('vendor/autoload.php');
/* Start to develop here. Best regards https://php-download.com/ */
bl4ckbon3 / strsim example snippets
use Edgaras\StrSim\Levenshtein;
use Edgaras\StrSim\DamerauLevenshtein;
use Edgaras\StrSim\Hamming;
use Edgaras\StrSim\Jaro;
use Edgaras\StrSim\JaroWinkler;
use Edgaras\StrSim\LCS;
use Edgaras\StrSim\SmithWaterman;
use Edgaras\StrSim\NeedlemanWunsch;
use Edgaras\StrSim\Cosine;
use Edgaras\StrSim\Jaccard;
use Edgaras\StrSim\MongeElkan;
// Detecting spelling error distance in user input
Levenshtein::distance("kitten", "sitting"); // Returns: 3
// Detecting typo distance with transposition correction
DamerauLevenshtein::distance("abcd", "acbd"); // Returns: 1
// Bit-level error detection (equal-length only)
Hamming::distance("1011101", "1001001"); // Returns: 2
// Comparing short strings with transposition support
Jaro::similarity("dixon", "dicksonx"); // Returns: 0.767 (similarity)
Jaro::distance("dixon", "dicksonx"); // Returns: 0.233 (distance = 1 - similarity)
// Matching names with common prefixes
JaroWinkler::similarity("martha", "marhta"); // Returns: 0.961 (similarity)
JaroWinkler::distance("martha", "marhta"); // Returns: 0.039 (distance = 1 - similarity)
// Finding common subsequence in DNA fragments
LCS::length("ACCGGTCGAGTGCGCGGAAGCCGGCCGAA", "GTCGTTCGGAATGCCGTTGCTCTGTAAA"); // Returns: 13
// Local alignment score for substring match
SmithWaterman::score("ACACACTA", "AGCACACA"); // Returns: 11
// Global alignment score for complete sequence match
NeedlemanWunsch::score("GATTACA", "GCATGCU"); // Returns: 0
// Comparing word frequency in short texts
Cosine::similarity("night", "nacht"); // Returns: 0.6
// Comparing embedding vectors from NLP model
Cosine::similarityFromVectors([0.1, 0.2, 0.3], [0.1, 0.3, 0.4]); // Returns: 0.925
// Comparing token overlap in short strings
Jaccard::index("abc", "bcd"); // Returns: 0.5
// Fuzzy match between two multi-word names
MongeElkan::similarity("john smith", "jon smythe"); // Returns: 0.822
// All algorithms support Unicode characters
Levenshtein::distance("café", "caffe"); // Returns: 2
Levenshtein::distance("こんにちは", "こんにちわ"); // Returns: 1
// Emoji and complex characters
Levenshtein::distance("🚀🌟", "🚀⭐"); // Returns: 1
Hamming::distance("👍🏽", "👍🏾"); // Returns: 1
// Different scripts and languages
Jaro::similarity("привет", "привет"); // Returns: 1.0 (identical)
Jaro::distance("привет", "привет"); // Returns: 0.0 (no distance)
JaroWinkler::similarity("عربي", "عربى"); // Returns: 0.9 (high similarity)
JaroWinkler::distance("عربي", "عربى"); // Returns: 0.1 (low distance)
// ZWJ sequences and combining marks
Levenshtein::distance("👨👩👧👦", "👨👩👧👦"); // Returns: 3
Levenshtein::distance("é", "e\u{0301}"); // Returns: 2
try {
// This will throw InvalidArgumentException for unequal lengths
Hamming::distance("abc", "abcd");
} catch (InvalidArgumentException $e) {
echo $e->getMessage(); // "Strings must be of equal length."
}
try {
// This will throw InvalidArgumentException for invalid UTF-8
Levenshtein::distance("valid", "\xFF\xFF");
} catch (InvalidArgumentException $e) {
echo $e->getMessage(); // "Input strings must be valid UTF-8."
}
try {
// This will throw InvalidArgumentException for mismatched vector lengths
Cosine::similarityFromVectors([1, 2], [1, 2, 3]);
} catch (InvalidArgumentException $e) {
echo $e->getMessage(); // "Vectors must be the same length."
}
Loading please wait ...
Before you can download the PHP files, the dependencies should be resolved. This can take some minutes. Please be patient.