1. Go to this page and download the library: Download amelaye/biophp library. Choose the download type require.
2. Extract the ZIP file and open the index.php.
3. Add this code to the index.php.
<?php
require_once('vendor/autoload.php');
/* Start to develop here. Best regards https://php-download.com/ */
amelaye / biophp example snippets
Amelaye\BioPHP\Domain\Sequence\Service\SequenceManager;
use Doctrine\Common\Annotations\AnnotationRegistry;
AnnotationRegistry::registerLoader('class_exists');
$client = new GuzzleHttp\Client([
'base_uri' => 'http://api.amelayes-biophp.net'
]);
$serializer = JMS\Serializer\SerializerBuilder::create()
->build();
$aminoApiManager = new \Amelaye\BioPHP\Api\AminoApi($client, $serializer);
$nucleotidManager = new \Amelaye\BioPHP\Api\NucleotidApi($client, $serializer);
$elementManager = new \Amelaye\BioPHP\Api\ElementApi($client, $serializer);
$sequenceManager = new SequenceManager($aminoApiManager, $nucleotidManager, $elementManager);
$aMirrors = $sequenceManager->findMirror("AGGGAATTAAGTAAATGGTAGTGG", 6, 8, 'E');
echo "<pre>";
var_dump($aMirrors);
echo "<pre>";
Loading please wait ...
Before you can download the PHP files, the dependencies should be resolved. This can take some minutes. Please be patient.